GRCh38 · COSMIC v90

Overview

This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Syntax:
chr21:g.33085132_33092105del
Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST26433 intrachromosomal deletion 21 31712818 + 21 31719793 + CTCCCAAAGTGCTGGGATTACAGGCGTGAGCCAC

Samples

This section shows the associated samples/tissues for the rearrangement.

Samples
1230672
Tissue
breast