GRCh38 · COSMIC v89

Overview

This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Syntax:
chr14:g.30884126_32927555dup
Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST26181 intrachromosomal tandem duplication 14 30884126 - 14 32927555 - CTCAGAGCCTCGGGTTAACAGAAGTCC

Samples

This section shows the associated samples/tissues for the rearrangement.

Samples
1304519
Tissue
breast