GRCh38 · COSMIC v90

Overview

This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Syntax:
chr5:g.o51884768_chrX:o27540868bkpt
Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST25593 Interchromosomal unknown type 5 51884768 - X 27540868 - CAATAACAATTTAGAAAAAT

Samples

This section shows the associated samples/tissues for the rearrangement.

Samples
1351059
Tissue
breast