GRCh38 · COSMIC v90

Overview

This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Syntax:
chr3:g.73983710_74113802dup
Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST25447 intrachromosomal tandem duplication 3 73983710 - 3 74113802 - ATCAGTGATTTCACGATGCTGCCATCTCT

Samples

This section shows the associated samples/tissues for the rearrangement.

Samples
1317020
Tissue
breast