GRCh38 · COSMIC v89

Overview

This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Syntax:
chr1:g.224458901_224612418dup
Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST20246 intrachromosomal tandem duplication 1 224458901 - 1 224612418 - gctagagcagctcacagaactgctatagtaagttttg

Samples

This section shows the associated samples/tissues for the rearrangement.

Samples
687448
Tissue
skin