GRCh38 · COSMIC v88

Overview

This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Syntax:
chr20:g.19183299_19282287dup
Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST17117 intrachromosomal tandem duplication 20 19183299 - 20 19282287 - ttttttttttggtttttggttggttttggttttggttttccggggggg

Samples

This section shows the associated samples/tissues for the rearrangement.

Samples
749711
Tissue
breast