GRCh38 · COSMIC v99

Overview

This section shows a general overview of the selected mutation. It describes the source of the mutation i.e gene name/sample name/tissue name with unique ID, and also shows the mutation syntax at the amino acid and nucleotide sequence level. You can see more information on our help pages.

Genomic Mutation ID
Genomic mutation identifier (COSV) to indicate the definitive position of the variant on the genome. This identifier is trackable and stable between different versions of the release. Also, this identifier remains the same between different assemblies (GRCh37 and GRCh38).
COSV67719921
Legacy Identifier
Legacy mutation identifier (COSM) represents existing COSM mutation identifiers. This identifier remains the same between different assemblies (GRCh37 and GRCh38). All the COSM ids at the same genomic location have been collapsed into one representative COSM id. These ids are maintained to help track existing mutations.
COSN29568146
Gene name
ATP8A2
AA mutation
p.? (Unknown)
CDS mutation
c.77-33052_77-33051insAGTGAGTGTGTGTGTGTGAG (Insertion - intronic)
Nucleotides inserted
AGTGAGTGTGTGTGTGTGAG
Genomic coordinates
GRCh38, 13:25435925..25435926, view Ensembl contig
CDD
NP_057613.4
HomoloGene
4443, view the multiple sequence alignment
Ever confirmed somatic?
Yes
Remark
n/a
Recurrent
n/a
Drug resistance
n/a
Alternative Ids
These are internal identifiers that are unique to a mutation on a particular transcript and are displayed in the URL of the mutation pages. Therefore, several of these internal ids could be associated with a single genomic COSV id where the mutation has been mapped to all overlapping genes and transcripts. Similarly, since every COSM id is mapped to one COSV id (where genomic coordinates are known), each COSM id can also be associated with several alternative (internal) identifiers. These ids are expected to change between assemblies (GRCh37 and GRCh38) and between the releases.
n/a

Tissue distribution

This section displays the distribution of mutated samples and tissue types (top 5). You can see more information on our help pages.

Samples

This section displays a table of mutated samples, with tissue, histology and zygosity information. Publication information is also included, where available, with links to PUBMED.

Sample name Gene name Transcript Primary Tissue Tissue Subtype 1 Primary Histology Histology Subtype 1 Pubmed ID Zygosity Somatic Status Sample Type LOH Resistant Mutation Drugs

Pathways affected

No pathways affected.

References

This section displays a table of references for the mutation. You can see more information on the help pages.

Reference Title Author Year Journal Status COSMIC Pubmed