This section shows a general overview of the selected mutation. It describes the source of the mutation i.e gene name/sample name/tissue name with unique ID, and also shows the mutation syntax at the amino acid and nucleotide sequence level. You can see more information on our help pages.
- Genomic Mutation ID
Genomic mutation identifier (COSV) to indicate the definitive position of the variant on the genome. This identifier is trackable and stable between different versions of the release. Also, this identifier remains the same between different assemblies (GRCh37 and GRCh38).
- COSV67719921
- Legacy Identifier
Legacy mutation identifier (COSM) represents existing COSM mutation identifiers. This identifier remains the same between different assemblies (GRCh37 and GRCh38). All the COSM ids at the same genomic location have been collapsed into one representative COSM id. These ids are maintained to help track existing mutations.
- COSN29568146
- Gene name
- ATP8A2
- AA mutation
- p.? (Unknown)
- CDS mutation
- c.77-33052_77-33051insAGTGAGTGTGTGTGTGTGAG (Insertion - intronic)
- Nucleotides inserted
- AGTGAGTGTGTGTGTGTGAG
- Genomic coordinates
- GRCh38, 13:25435925..25435926, view Ensembl contig
- CDD
- NP_057613.4
- HomoloGene
- 4443, view the multiple sequence alignment
- Ever confirmed somatic?
- Yes
- Remark
- n/a
- Recurrent
- n/a
- Drug resistance
- n/a
- Alternative Ids
These are internal identifiers that are unique to a mutation on a particular transcript and are displayed in the URL of the mutation pages. Therefore, several of these internal ids could be associated with a single genomic COSV id where the mutation has been mapped to all overlapping genes and transcripts. Similarly, since every COSM id is mapped to one COSV id (where genomic coordinates are known), each COSM id can also be associated with several alternative (internal) identifiers. These ids are expected to change between assemblies (GRCh37 and GRCh38) and between the releases.
- n/a