GRCh38 · COSMIC v83

Overview

This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Syntax:
chr8:g.o47519325_chr15:o25428169bkpt
Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST26464 Interchromosomal unknown type 8 47519325 - 15 25428169 - GTAATCCGCCTGGGATTACAGGCGCATGCCACCATGCCCAAC

Samples

This section shows the associated samples/tissues for the rearrangement.

Samples
1230672
Tissue
breast