GRCh38 · COSMIC v82

Overview

This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Syntax:
chr2:g.9863739_20409580dup
Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST26431 intrachromosomal tandem duplication 2 9863739 - 2 20409580 - CTGTATTCAGGAAACCCATCTCACATGCAGAGACACACATAGGCTCA

Samples

This section shows the associated samples/tissues for the rearrangement.

Samples
1230672, 1230672
Tissue
breast