GRCh38 · COSMIC v83

Overview

This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Syntax:
chr5:g.18242882_chr7:o86510693bkpt
Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST25501 Interchromosomal unknown type 5 18242882 + 7 86510693 - CTCGTTTTCAAAATCCCCACAGCACATTT

Samples

This section shows the associated samples/tissues for the rearrangement.

Samples
1317020
Tissue
breast