GRCh38 · COSMIC v82


This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST16521 intrachromosomal deletion 16 11210609 + 16 11214812 + gtatatattgtggggctgaaaacagtatatatagcactatat


This section shows the associated samples/tissues for the rearrangement.
