GRCh38 · COSMIC v82

Overview

This section shows an overview table of the rearrangement breakpoints. You can see more information on the help pages.

Syntax:
chr19:g.5807715_6801570dup
Mutation ID (COST) Mutation Description Chromosome From Breakpoint From (GRCh38) Strand From Chromosome To Breakpoint To (GRCh38) Strand To Non Templated Inserted Seq
COST16302 intrachromosomal tandem duplication 19 5807715 - 19 6801570 - tggtcgaatctgggagccctc

Samples

This section shows the associated samples/tissues for the rearrangement.

Samples
1126506
Tissue
breast